igg3 isotype control pe  (SouthernBiotech)

Journal: STAR Protocols

Article Title: Protocol to develop human alveolar macrophage-like cells from mononuclear cells or purified monocytes for use in respiratory biology research

doi: 10.1016/j.xpro.2024.103061

Figure Lengend Snippet: Suggested antibodies for AML cell phenotyping by flow cytometry

Article Snippet: Mouse IgG3 isotype control-PE (1:50 dilution) , eBioscience , Cat#12-4742-42 RRID: AB_10733011.

Techniques: Control

Journal: STAR Protocols

Article Title: Protocol to develop human alveolar macrophage-like cells from mononuclear cells or purified monocytes for use in respiratory biology research

doi: 10.1016/j.xpro.2024.103061

Figure Lengend Snippet:

Article Snippet: Mouse IgG3 isotype control-PE (1:50 dilution) , eBioscience , Cat#12-4742-42 RRID: AB_10733011.

Techniques: Control, Blocking Assay, Staining, Recombinant, Isolation, Software, Real-time Polymerase Chain Reaction, Microscopy, Sterility

Journal: Frontiers in Immunology

Article Title: GrpE Immunization Protects Against Ureaplasma urealyticum Infection in BALB/C Mice

doi: 10.3389/fimmu.2020.01495

Figure Lengend Snippet: Effect of GrpE vaccination on Ig antibody production, including IgG subclasses. Three groups of BALB/c mice were immunized intramuscularly with PBS, FA or GrpE. Six mice from each group were sacrificed and sera were separated on day 14 after the last injection. Specific antibody levels in sera were assessed by ELISA: (A) anti-GrpE antibody titer; (B) GrpE-specific antibody levels and IgG subclass levels. Each bar indicates the mean ± SD of triplicates from six mice per group. t -test, *** P < 0.001, ** P < 0.01.

Article Snippet: After washing four times with PBST, 50 μL of horseradish peroxidase (HRP)-conjugated goat anti-mouse immunoglobulin G (IgG), IgG1, IgG2a, IgG3, and IgA, IgM antibodies (Protein Tech Group, Chicago, IL) was added to each serum well at 37°C for 1 h, respectively.

Techniques: Injection, Enzyme-linked Immunosorbent Assay

Journal: Stem cell research

Article Title: Generation of an induced pluripotent stem cell line (CSCRMi001-A) from a patient with a new type of limb-girdle muscular dystrophy (LGMD) due to a missense mutation in POGLUT1 (Rumi)

doi: 10.1016/j.scr.2017.08.020

Figure Lengend Snippet: Reagents details

Article Snippet: Isotype control antibody , Mouse IgG3 Isotype Control, PE , 1:20 , ThermoFisher, Cat# 12-4742-42.

Techniques: Immunocytochemistry, Marker, Control, Mutagenesis, Amplification, Sequencing

Journal: Stem cell research

Article Title: Generation of an induced pluripotent stem cell line (CSCRMi001-A) from a patient with a new type of limb-girdle muscular dystrophy (LGMD) due to a missense mutation in POGLUT1 (Rumi)

doi: 10.1016/j.scr.2017.08.020

Figure Lengend Snippet: Reagents details

Article Snippet: A 500 bp band appears for mycoplasma-positive cells, and no band appears for mycoplasma-negative cells. table ft1 table-wrap mode="anchored" t5 caption a7 Antibodies used for immunocytochemistry/flow-cytometry Antibody Dilution Company Cat # and RRID Pluripotency Marker Rabbit mAb anti-OCT4A 1:400 StemLight kit, Cell Signaling Technology, Cat# 9092 Pluripotency Marker Rabbit mAb anti-SOX2 1:400 StemLight kit, Cell Signaling Technology, Cat# 9092 Pluripotency Marker Rabbit mAb anti-NANOG 1:400 StemLight kit, Cell Signaling Technology, Cat# 9092 Pluripotency Marker Rabbit mAb anti-LIN28A 1:400 StemLight kit, Cell Signaling Technology, Cat# 9092 Pluripotency Marker PE-conjugated mouse mAb anti-SSEA4 1:20 ThermoFisher, Cat# 12-8843-41 Secondary antibody Goat anti-Rabbit IgG Alexa Fluor Plus 488 1:500 ThermoFisher, Cat# {"type":"entrez-nucleotide","attrs":{"text":"A32731","term_id":"1567579","term_text":"A32731"}} A32731 Isotype control antibody Mouse IgG3 Isotype Control, PE 1:20 ThermoFisher, Cat# 12-4742-42 Primers Target Forward/Reverse primer (5′-3′) Mycoplasma detection Mycoplasma 16S rRNA GGCGAATGGGTGAGTAACACG CGGATAACGCTTGCGACCTATG POGLUT1 mutation fragment amplification A 506-bp amplicon containing mutation region TGACCTGAACAACATACCCTTCA GCTAATGCTGGTTCATGGAACTT POGLUT1 amplicon sequencing A 20-bp region located 125-bp upstream of the mutation within the amplicon GTCCTAGTCCTGCTCACCTT Open in a separate window Reagents details POGLUT1 mutation detection Genomic DNA was extracted and a pair of primers was designed to amplify the POGLUT1 mutation fragment from DNA.

Techniques: Immunocytochemistry, Marker, Control, Mutagenesis, Amplification, Sequencing